Syfilis-bilaga 5

Hoppa till: navigering, sök

Huvudartikel: Syfilis


SekundÀrartikel till: Syfilis-laboratoridiagnostik


Metoder för diagnostik av Treponema pallidum

5.1. Metodbeskrivning för PCR-detektion av Treponema pallidum (ej referensmetod)

5.1.1. Provtagningsmaterial och provtagning

Pinnprov frÄn sÄrkant (pinnskaftet ska ej vara av trÀ) för transport i koksalt, PBS eller transportmedel avsett för odling. LÀmplig pinne Àr Copan 155C (pinne av plast med rayontip). Prov frÄn andra provtagningslokaler transporteras som för odling. LÀmpligt transportmedium Àr Copan 114C.USE (kolat medium, provtagningspinne som ovan).

Prov förvaras i kyl fram till omhÀndertagandet.

5.1.2. Provhantering pÄ laboratoriet

SĂ„r: Överför provtagningspinne till centrifugrör med 200 mL PBS/koksalt alternativt 1 mL av provet om detta transporterats i PBS/koksalt. Centrifugera 12 000 × g 10 min. HĂ€ll av supernatanten.

Nukleinsyra extraheras frÄn provet med valfri metod. PÄ bakteriologiska laboratoriet i Göteborg anvÀnds Roche Amplicor, sputum sample preparation kit enligt leverantörens instruktioner.

  • Likvor: 1 mL likvor centrifugeras 12 000 × g 10 min i 1,5 ml centrifugrör. FortsĂ€tt enligt ovan provmaterial frĂ„n sĂ„r.

Nukleinsyraamplifiering med PCR Primrar för detektion av bmp-genen kodande för 47-kDa membran immunogen (basic membrane protein)

    • KO3A Forward 5’ GAAGTTTGTCCCAGTTGCGGTT3’
    • KO4 Reverse 5’ CAGAGCCATCAGCCCTTTTCA3’


Amplifiering med ovanstÄende primerpar ger ett DNA-fragment av storleken 239 bp.

Mix / PCR-rör

Syfilismastermix.jpg


5.2. Serologisk diagnostik av syfilis (referensmetoder)

AllmÀnt

Infektioner med T. pallidum ger upphov till ett flertal antikroppar och dessa indelas i tvÄ grupper:

  • 1). Ospecifika antikroppar riktade mot lipoidalt antigen i T. pallidums cellvĂ€gg och sĂ„dant lipoidalt antigen som uppstĂ„r genom vĂ€vnadsskada vid interaktion mellan vĂ€rd och mikroorganism men Ă€ven vid andra sjukdomstillstĂ„nd.
  • 2). Specifika antitreponemala antikroppar riktade mot T. pallidum och som bestĂ€ms genom att man anvĂ€nder hela bakterier eller preparation av dessa som antigen. SĂ„dana antikroppar Ă€r av tvĂ„ typer, nĂ€mligen gruppspecifika antikroppar Ă€ven mot icke patogena spiroketer och antikroppar specifika för T. pallidum.

Humorala antikroppar mot T. pallidum saknar sannolikt helt skyddseffekt mot förnyad infektion. Förekomst av specifika IgM-antikroppar talar för aktiv infektion. Dessa antikroppar kan dock vara svÄra att pÄvisa vid sena infektioner med höga IgG-nivÄer.

A. Ospecifika test

  • Flockningsreaktioner/reagintester som
    • Venereal Disease Research Laboratory (VDRL) test eller
    • Rapid plasma reagin (RPR) test
  • Komplementbindningsreaktion
  • Wasserman-reaktion (WR)

B. Specifika antitreponemala test

  • Treponema passiv particle-agglutination (TPPA)
  • IgM-ELISA
  • Analysinstrument, exempelvis Abbotts Architect

5.2.1. VDRL/RPR

Analysprincip/Teststrategi

Vid reaktionen mellan ospecifika serumantikroppar (reaginer) och kardiolipin – lecitin – kolesterolantigen (VDRL-antigen) bildas aggregat. Denna aggregatbildning kan avlĂ€sas direkt i mikroskop (VDRL-test), eller okulĂ€rt vilket underlĂ€ttas av tillsatta mikropartiklar av kol i antigenberedningen (RPR-test). Testerna Ă€r lĂ€tta att standardisera och har i stort sett samma prestanda. Vid VDRL-testen sĂ€tts antigenet till inaktiverat serum (observera att likvor inte skall vara inaktiverat), varefter eventuell aggregation av partiklar avlĂ€ses i mikroskop. För RPR-testet anvĂ€nds icke inaktiverat serum. Testerna kan med fördel utföras kvantitativt genom att antigenet sĂ€tts till olika spĂ€dningar av serum eller likvor. I svaret anges högsta spĂ€dning som ger positiv reaktion. Det bör noteras att om man endast anvĂ€nder VDRL-antigen i en lĂ„g serumspĂ€dning finns risk för prozonfenomen, det vill sĂ€ga falskt negativt resultat vid mycket höga antikroppsnivĂ„er.

VDRL/RPR anvÀnds dels vid primÀr screening av blodgivare och gravida och dessutom vid utredning av misstÀnkt syfilis inklusive neurosyfilis. MÄnga svenska laboratorier har övergÄtt till att primÀrt anvÀnda specifika tester (se Abbotts Architect Syphilis TP-test, denna bilaga). Ospecifika tester kan ibland bli snabbare positiva vid tidig syfilis och har dÀrför Ànnu en plats som komplement vid primÀrdiagnostiken. TPPA har dock till skillnad frÄn den tidigare rekommenderade TPI lika hög sensitivitet som VDRL vid primÀr lues. Vid misstanke om neurosyfilis skall VDRL/RPR anvÀndas för primÀr undersökning av likvor.

Titrering av serum för kvantitativ analys med ospecifik test Àr anvÀndbart för att följa behandlingsresultatet. Efter avslutad behandling för primÀr eller sekundÀr syfilis utförs testning efter tre, sex och tolv mÄnader. Vid kvarstÄende titer genomförs ytterligare test efter 24 mÄnader. Observera att de ospecifika reaginerna i normalfallet inte lÀngre kan pÄvisas efter cirka 1-2 Är efter genomförd behandling. LivslÄngt kvarstÄende titrar kan dock förekomma, framförallt vid sent insatt behandling. Efter behandling av neurolues bör undersökning av likvor göras efter sex mÄnader. Reagintesterna kan dÄ ha blivit negativa.

Referenssera/Kontrollsera

PrimÀr kalibrator Àr densamma för alla serologiska syfilistester (1:st international WHO standard human syphilis). Testerna kalibreras 2 gÄnger Ärligen med detta serum. Positiv kontroll tillverkas pÄ det enskilda laboratoriet och anvÀnds vid varje testomgÄng.

Analysproceduren

Nedan beskrivs kortfattat den vanligt förekommande kommersiella RPR-testen ”Murex VDRL-antigen med kolpartiklar”. Produkten Ă€r CE-mĂ€rkt enligt IVD-direktivet.

Testen utförs pÄ objektglas eller ljus analysbricka med ringar, cirka 18 mm i diameter.

  • Blanda 16 ”L VDRL antigensuspension med 50 ”L prov pĂ„ glaset eller analysbrickan.
  • Skaka glaset eller analysbrickan 8 minuter pĂ„ en skakapparat med horisontell plattform som roterar 100 varv/min med en rotationsdiameter pĂ„ 18-22 mm.
  • AvlĂ€s resultatet visuellt i god belysning. Ett positivt resultat indikeras genom att klart synliga svarta aggregat av partiklar utvecklas.

Titrering av prover görs i serien 1, 1/2 -1/128. Det Àr lÀmpligt att utföra titrering upp till 1/16 redan primÀrt för att undvika eventuellt prozonfenomen. Titer rapporteras till klinik.

Tolkning och prestanda

Ett positivt resultat indikerar förekomst av reagin, men Ă€r inte liktydigt med diagnosen syfilis. I litteraturen anges sensitiviteten för dessa tester till 74-100 % för primĂ€r syfilis, nĂ€rmare 100 % vid sekundĂ€r eller latent syfilis, men bara 37-94 % vid sen syfilis. Specificiteten Ă€r cirka 93-99 %. Vid neurosyfilis Ă€r kĂ€nsligheten maximalt cirka 70 %, men positiv test pĂ„ likvor anses liktydlig med neurosyfilis. Det skall observeras att pĂ„visbara reaginer uppstĂ„r först efter cirka 4-6 veckor efter infektionstillfĂ€llet. VDRL Ă€r ospecifikt positivt i cirka 1 % av blodgivarsera. Observera att VDRL-titrering ger lĂ€gre titrar och sĂ€mre reproducerbarhet Ă€n WR och TPPA.

BÄde falskt negativa och biologiskt falskt positiva (BFP) resultat ur ett diagnostiskt perspektiv kan erhÄllas med flockningstester. Upprepade positiva testresultat tillsammans med negativa specifika antitreponemala tester orsakas ofta av herpes genitalis. Som orsak till övergÄende BFP har ocksÄ angivits graviditet, narkotikamissbruk, mykoplasmapneumoni, tuberkulos och malaria. Vid bestÄende (lÀngre Àn 6 mÄnader) BFP kan orsakerna vara autoimmun sjukdom som SLE, reumatoid artrit, autoimmun struma, poyarteritis nodosa, levercirros, malignitet, narkotikamissbruk och lepra. I över hÀlften av bestÄende BFP finner man emellertid ingen orsak. Detta Àr vanligare hos Àldre och kan vara familjÀrt betingat. Vid BFP Àr det ofta inkongruens mellan VDRL/RPR och WR-testerna.

Svarsrutiner

VDRL/RPR-resultatet anges som positivt/negativt med angivande av eventuell titer.

REFERENSER

  • 1. Hook EW, Marra CM. Acquired syphilis in adults. N Engl J Med. 1992; 326: 1060-1065

5.2.2. Wassermanreaktion (WR)

Analysprincip/Teststrategi

I ett första steg binds i provet förekommande reaginer till kardiolipinantigen (VDRL-antigen) varvid ett antigen/antikroppskomplex bildas. Samtidigt tillsĂ€tts ett hemolytiskt system bestĂ„ende av sensibiliserade fĂ„rblodkroppar, amboceptor (antikroppar mot fĂ„rblodkroppar) och marsvinskomplement. Eftersom komplementet binds till antigen/antikroppskomplexet hemolyseras inte blodkropparna av amboceptorn, utan dessa sjunker till botten. Om provet saknar reaginer Ă€r komplementet fritt och bidrar till lys av blodkropparna. I svaret anges den högsta serumspĂ€dning som ger 50 % hemolys eller mindre.

Analysen rekommenderas som kompletterande ospecifikt test vid utredning av misstÀnkt syfilis, i första hand vid sannolika biologiskt falskt positiva (BFP) VDRL/RPR-resultat. PÄ grund av sin nÄgot högre kvantitering och reproducerbarhet kan WR vara att föredra framför flockningstesterna vid uppföljning av behandlingsresultat. Testerna Àr för övrigt prestandamÀssigt i stort sett likvÀrdiga, men WR Àr nÄgot mer arbetsintensiv.

Referenssera/Kontrollsera

PrimÀr kalibrator Àr densamma för alla serologiska syfilistester (1:st international WHO standard human syphilis). Testerna kalibreras 2 gÄnger Ärligen med detta serum. Positiv och negativ kontroll tillverkas pÄ det enskilda laboratoriet och anvÀnds vid varje testomgÄng. Positiv tillverkas frÄn positiva patientprover och spÀdes till lÀmplig titernivÄ med primÀr kalibrator som jÀmförelse. Titreringen skall utföras vid tre separata tillfÀllen.

Analysproceduren

  • I ett första steg utförs amboceptortitrering i provrör (görs vid batchbyte). DĂ€rvid tillsĂ€tts komplement i överskott och amboceptor i den minsta mĂ€ngd som ger fullstĂ€ndig hemolys. Man söker den spĂ€dning som innehĂ„ller 6 enheter/0,025 mL buffert.
  • I ett andra steg utförs pĂ„ motsvarande sĂ€tt komplementtitrering, varvid man anvĂ€nder titrerad amboceptor. Man söker den komplementspĂ€dning som innehĂ„ller 1,5 enheter/0,025 mL, varvid 1 enhet Ă€r den minsta mĂ€ngd komplement som ger fullstĂ€ndig hemolys.
  • Testet utförs enligt medföljande anvisningar. I princip blandas patientserum i olika spĂ€dningssteg med antigensuspension, 2 % fĂ„rblod, och uttitrerad amboceptor och komplement i mikrotiterplattor. Brunnar utan antigensuspension bereds ocksĂ„ för varje prov för att möjliggöra bedömning av eventuell antikomplementĂ€r aktivitet hos proven. Plattorna inkuberas i 37 ÂșC i en timme, varefter de sĂ€tts i kylskĂ„p för att tillĂ„ta att kvarvarande blodkroppar kan sjunka till botten.
  • Resultatet avlĂ€ses varvid bedömning görs av hemolys som protokollförs som - eller + (positivt resultat) och ++ eller +++ (negativt resultat).

Tolkning och prestanda

Ett prov med <50 % hemolys i godkĂ€nd omgĂ„ng betraktas som positivt och uttitreras om sĂ„ inte skett frĂ„n början. Om provet Ă€r starkt antikomplementĂ€rt (bĂ„de prov och serumkontroll ger <50 % hemolys) titreras detta vidare med och utan antigen för att bedöma graden av antikomplementĂ€r aktivitet i provet. AllmĂ€nna prestanda Ă€r i princip desamma som för VDRL/RPR.

KvalitetssÀkring

TvÄ egentillverkade kontroller (positiv och negativ) medtages vid varje analystillfÀlle. Dessa skall vara kalibrerade mot primÀr kalibrator och fÄr avvika högst ett spÀdningssteg för godkÀnd analysomgÄng.

Svarsrutiner

WR svaras ut som positiv med angivande av titer (den högsta spĂ€dning som ger <50 % hemolys) eller negativ (>50 % hemolys).

REFERENSER

  • 1. Wassermann, A., Neisser, A. and Bruck, C. Eine serodiagnostische Reaktion bei Syphilis. Dtsch. med. Wschr. 1906; 32:745.

5.2.3 TPPA

Analysprincip/Teststrategi

För analysen anvÀnds speciella bÀrarpartiklar av gelatin som har sensibiliserats med renade patogena T. pallidum (Nichols stam). Principen för testen Àr att dessa partiklar agglutinerar i nÀrvaro av specifika antitreponemala antikroppar i humant serum eller human plasma.

I föregÄende upplaga av denna bok angavs för verifiering T. pallidum hemagglutinationstest (TPHA) som referensmetod. TPPA Àr snabbare och enklare att utföra samt avlÀsa men har för övrigt samma prestanda och ersÀtter dÀrför TPHA som referensmetod. FTA-abs rekommenderas inte lÀngre, och TPI Àr inte lÀngre tillgÀnglig.

Referenssera/Kontrollsera

PrimÀr kalibrator Àr densamma för alla serologiska syfilistester (1:st international WHO standard human syphilis). Testerna kalibreras 2 gÄnger Ärligen med detta serum. Positiv kontroll tillverkas pÄ det enskilda laboratoriet och anvÀnds vid varje testomgÄng.

Analysproceduren

Nedan beskrivs kortfattat en kommersiell TPPA, Serodia –TP.PA (Fujirebio inc). Produkten Ă€r CE-mĂ€rkt enligt DVD-direktivet.

  • I förpackningen ingĂ„r frystorkade sensibiliserade och icke-sensibiliserade gelatinpartiklar som rekonstitueras med sĂ€rskild medföljande lösning och 100 ÎŒL av respektive lösningar sĂ€tts till första brunnarna i mikrotiterplattor. Till följande brunnar sĂ€tts 25 ÎŒL av lösningarna.
  • Icke inaktiverat serum eller plasma och positiv kontroll liksom laboratoriets egentillverkade positiva kontroll sĂ€tts till första brunnen och titreras dĂ€refter i de följande brunnarna enligt medföljande anvisningar. Mixa.
  • Inkubera utan agitation i rumstemperatur mellan 2 timmar och ett dygn. AvlĂ€s dĂ€refter.
  • Plattorna avlĂ€ses okulĂ€rt. Ett negativt resultat karakteriseras av att partiklarna sedimenterat ner till botten av brunnen och dĂ€r centralt format en distinkt pellet. Ett positivt resultat karakteriseras av att agglutinerade partiklar sedimenterat till ett jĂ€mnt skikt i botten pĂ„ brunnen. Svagt positiva reaktioner förekommer som mellanformer (kompakt ring av partiklar eller stor ring med oskarpa kanter).

Tolkning och prestanda

För godkÀnd analysomgÄng skall reaktionerna med osensibiliserade gelatinpartiklar uniformt utfalla negativt och positiv kitkontroll skall ha en titer pÄ 1/320. Egen positiv kontroll skall uppfylla uppsatta kriterier. Omtestning bör ske om Àven osensibiliserade partiklar orsakat agglutination. DÀrvid absorberas först provet mot rekonstituerade osensibiliserade partiklar enligt medföljande anvisningar.

Analysen har hög sensitivitet, dvs. motsvarande 70-90 % vid primĂ€r syfilis, i senare stadier av sjukdomen Ă€r sensitiviteten nĂ€ra 100 %. Specificiteten Ă€r ocksĂ„ hög och överstiger 95 %. De specifika antikropparna utvecklas nĂ„got senare i sjukdomsförloppet Ă€n de ospecifika reaginerna (se ovan) och börjar upptrĂ€da mellan 5-12 veckor efter infektionstillfĂ€llet. DĂ€remot kvarstĂ„r antikroppsnivĂ„erna livslĂ„ngt, varför specifika tester inte kan anvĂ€ndas för bedömning av behandlingseffekt.

Svarsrutiner

Resultatet av godkÀnd testning rapporteras som TPPA negativ eller positiv med angivande av titer.


5.2.4. Specifik syfilisserologi utförd med ELISA-teknik

Analysprincip/Teststrategi

Flera specifika EIA-tester baserade pÄ T. pallidum-sonikat eller rekombinanta antigen har utvecklats för syfilisdiagnostik. Kommersiella sÄdana har i olika publikationer visats ha samma sensitivitet och specificitet som övriga specifika syfilistester. Captia Syphilis-M test pÄvisar IgM-antikroppar och rekommenderas bland annat för att pÄvisa kongenital syfilis. Western blot baserade EIA-tester Àr ocksÄ under utveckling. Western blot tester som detekterar IgM antikroppar mot T. pallidum har i vissa studier till och med uppvisat högre sensitivitet och specificitet Àn ELISA vid diagnostik av kongenital syfilis.

IgM-ELISA rekommenderas i dag som verifierande specifik test tillsammans med TPPA nÀr ospecifika tester utfallit positivt. Specifika IgM-antikroppar upptrÀder visserligen nÄgot senare Àn de ospecifika reaginerna, men blir ofta positiv innan andra specifika tester blir det. DÀrmed kan testen anvÀndas för att pÄvisa primÀr syfilis, tidigt i förloppet. Vissa studier talar för att IgM-antikroppar Àven upptrÀder vid reinfektion. IgM-ELISA Àr ocksÄ anvÀndbar för att pÄvisa anti-TP-antikroppar vid misstÀnkt kongenital syfilis. SÄdana antikroppar kan inte överföras frÄn mor till barn, varför förekomst av sÄdana i blodprov frÄn barnet indikerar kongenital syfilis.

Referenssera/Kontrollsera

PrimÀr kalibrator Àr densamma som för övriga diagnostiska syfilis-tester (se ovan).

Analysproceduren

Utförs enligt tillverkarens anvisningar.

Tolkning och prestanda

Reaktiviteten för IgM-testerna motsvarar i huvudsak TTPA, utom vid reinfektioner dÄ kÀnsligheten Àr lÀgre. Risk för falskt positiva resultat föreligger om serum innehÄller reumafaktor.

Svarsrutiner

Resultaten av tekniskt godkÀnd testning rapporteras som fynd av specifika IgM-antikroppar pÄvisade/ej pÄvisade.

REFERENSER

  • 1. Lefevre, J.C., Bertrand, M.A., och Bauriand, R. Evaluation of the Captia Enzyme immunoassays for detection of immunoglobulins G and M to T. pallidum in syphilis. J. Clin. Microbiol. 1990; 28(8):1704-1707.

5.2.5. Specifik syfilisserologi utförd pÄ kommersiella analysinstrument

Analysprincip/Teststrategi

Specifika antikroppar mot T. pallidum kan pĂ„visas med olika tekniker och ett flertal kommersiella applikationer finns att tillgĂ„. Förutom TPPA och olika ELISA-baserade metoder för pĂ„visande av i huvudsak IgM Ă€r anvĂ€ndandet av olika fabrikat av automatiserade analysutrustningar spridd vid landets mikrobiologiska laboratorier. Exempel pĂ„ sĂ„dan utrustning Ă€r ArchitectÂź (Abbott) och LiaisonÂź (DiaSorin), avsedda för screening av stora provmĂ€ngder, exempelvis frĂ„n blodgivare, plasmagivare eller gravida. Testerna pĂ„visar specifika anti-T. pallidum-antikroppar med varianter av kemilumiscensmetoder och har i jĂ€mförande studier befunnits likvĂ€rdiga med sensitivitet och specificitet pĂ„ >99 % jĂ€mfört med EIA-tester och TPPA (1). Dessa och likvĂ€rdiga metoder kan dĂ€rför anses utgöra standard för screening av blodgivare, plasmagivare, gravida och vara ett alternativ till VDRL/RPR vid utredning av misstĂ€nkt syfilis.

Referenssera/Kontrollsera

PrimÀr kalibrator Àr densamma som för övriga diagnostiska syfilis-tester (se ovan).

Analysproceduren

HÀr beskrivs som exempel kortfattat provhanteringen i Architect. Analysen (Chemiluminescent Microparticle Immunoassay, förkortas CMIA) utförs automatiskt i tvÄ steg. Den anvÀnder rekombinanta specifika antigen med den ungefÀrliga storleken 15, 17 och 47 kDalton klÀdda till mikropartiklar. Fabrikanten tillhandahÄller med varje kit en kalibrator som skall anvÀndas i tre replikat vid kalibrering av metoden. Kalibreringen kontrolleras mot medföljande kitkontroller.

  • Patientserum sĂ€tts till antigenklĂ€dda mikropartiklar suspenderade i buffert varvid eventuella anti-TP-antikroppar i provet binder till partiklarna. AkridinmĂ€rkt anti-humant IgG – och IgM-konjugat tillsĂ€tts och dĂ€refter tvĂ„ olika triggerlösningar.
  • Den följande kemilumiscerande reaktionen mĂ€ts i relativa ljusenheter (RLU). Det rĂ„der en direkt relation mellan mĂ€ngden antikroppar i provet och uppmĂ€tta RLU.
  • Fabrikantens kit-kontroller och laboratoriets egentillverkade positiva kontroller anvĂ€nds vid varje analystillfĂ€lle. Cut-off-vĂ€rde bestĂ€ms som 0,2×erhĂ„llet vĂ€rde för kalibratorn.
  • Prover med S/CO-vĂ€rden <1,0 betraktas som icke-reaktiva (negativa). Prover med S/CO-vĂ€rden pĂ„ >1,0 betraktas som reaktiva (positiva).

Tolkning och prestanda

Analysens precision anges till <15 % av den medföljande positiva kontrollen. Initialt reaktiva prov centrifugeras för omtestning ×2. Om omtestningen blir negativ bĂ„da gĂ„nger betraktas provet som icke-reaktivt (negativt).

Svarsrutiner

Icke-reaktiva prover svaras ut som negativa. Svaret kan vid klinisk frÄgestÀllning kompletteras med önskan om nytt senare taget prov för pÄvisande av möjlig serokonversion (se under TPPA om tidpunkt för upptrÀdandet av specifika antikroppar).

Reaktiva prover svaras ut som positiva och kompletteras med TPPA och IgM-ELISA och eventuellt med VDRL/RPR/WR-titer.

REFERENSER

  • 1. Yoshioka N, Deguchi M et al. Evaluation of a chemiluminescent microparticle immunoassay for determination of Treponema pallidum antibodies. Clin Lab. 2007;53(9-12):597-603.